Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Golgi-TurboID
(Plasmid #200959)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200959 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Golgi-TurboID
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1089
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer cggccgccaccatgtacccgt
  • 3′ sequencing primer gtgactcgagcatgcatctag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

“Please visit https://www.biorxiv.org/content/10.1101/2023.01.22.525042v2 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Golgi-TurboID was a gift from Keriann Backus (Addgene plasmid # 200959 ; http://n2t.net/addgene:200959 ; RRID:Addgene_200959)
  • For your References section:

    Proximity-labeling chemoproteomics defines the subcellular cysteinome and inflammation-responsive mitochondrial redoxome. Yan T, Julio AR, Villanueva M, Jones AE, Ball AB, Boatner LM, Turmon AC, Nguyen KB, Yen SL, Desai HS, Divakaruni AS, Backus KM. Cell Chem Biol. 2023 Jul 20;30(7):811-827.e7. doi: 10.1016/j.chembiol.2023.06.008. Epub 2023 Jul 6. 10.1016/j.chembiol.2023.06.008 PubMed 37419112