Addgene: VEGF120TAG Skip to main content
Addgene

VEGF120TAG
(Plasmid #200946)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200946 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLJM1-EGFP
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 9519
  • Modifications to backbone
    Inserted EF1a-VEGF120TAG plus hPGK-PuroR, removed GFP
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    VEGF120TAG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    441
  • Mutation
    amber stop codon 101 bp from ATG
  • Entrez Gene
    Vegfa (a.k.a. L-VEGF, Vegf, Vpf)
  • Promoter Ef1a
  • Tag / Fusion Protein
    • 6x HIS (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    hPGK-driven Puromycin resistance
  • Species
    Synthetic
  • Insert Size (bp)
    1143
  • Promoter hPGK

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GCAACCTCCCCTTCTACGAGC
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.04.24.537801 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VEGF120TAG was a gift from Elizabeth Kirby (Addgene plasmid # 200946 ; http://n2t.net/addgene:200946 ; RRID:Addgene_200946)
  • For your References section:

    Neural stem and progenitor cells support and protect adult hippocampal function via vascular endothelial growth factor secretion. Miller LN, Walters AE, Denninger JK, Hanson MA, Marshall AH, Johantges AC, Hosawi M, Sebring G, Rieskamp JD, Ding T, Rindani R, Chen KS, Goldberg ME, Senthilvelan S, Volk A, Zhao F, Askwith C, Wester JC, Kirby ED. Mol Psychiatry. 2024 Nov 11. doi: 10.1038/s41380-024-02827-8. 10.1038/s41380-024-02827-8 PubMed 39528687