VEGF120TAG
(Plasmid
#200946)
-
PurposeEncodes recombinant mouse VEGF120 when coupled with amber stop codon suppression by non-canonical amino acid incorporation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200946 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLJM1-EGFP
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 9519
-
Modifications to backboneInserted EF1a-VEGF120TAG plus hPGK-PuroR, removed GFP
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameVEGF120TAG
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)441
-
Mutationamber stop codon 101 bp from ATG
-
Entrez GeneVegfa (a.k.a. L-VEGF, Vegf, Vpf)
- Promoter Ef1a
-
Tag
/ Fusion Protein
- 6x HIS (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehPGK-driven Puromycin resistance
-
SpeciesSynthetic
-
Insert Size (bp)1143
- Promoter hPGK
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GCAACCTCCCCTTCTACGAGC
- 3′ sequencing primer GTGGTTTGTCCAAACTCATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.04.24.537801 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VEGF120TAG was a gift from Elizabeth Kirby (Addgene plasmid # 200946 ; http://n2t.net/addgene:200946 ; RRID:Addgene_200946) -
For your References section:
Neural stem and progenitor cells support and protect adult hippocampal function via vascular endothelial growth factor secretion. Miller LN, Walters AE, Denninger JK, Hanson MA, Marshall AH, Johantges AC, Hosawi M, Sebring G, Rieskamp JD, Ding T, Rindani R, Chen KS, Goldberg ME, Senthilvelan S, Volk A, Zhao F, Askwith C, Wester JC, Kirby ED. Mol Psychiatry (2024). https://doi.org/10.1038/s41380-024-02827-8 10.1038/s41380-024-02827-8