lentiGuide-puro_Panc480-MT7
(Plasmid
#200941)
-
PurposeMultiplexed CRISPR array expressing 7 sgRNA in a lentiviral backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200941 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiGuide-puro
- Backbone size w/o insert (bp) 8306
- Total vector size (bp) 10542
-
Modifications to backboneMultiplex array of hU6 promoter, sgRNA, gRNA scaffold x7
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemultiplexed sgRNA array
-
gRNA/shRNA sequenceGGAATCATCTTCACAGTTGT;AATATCCTGCCACCTCTAAC;TCAGTCCAGTCAAAGGTGGA;CTAATGTATGACTGAAAGCT;GAGGTGTCTAAACCATGACA;GTGCACATCTTATCTCCCTT;TTAGGGGGCCAAGAGCGTAT
- Promoter hU6, EF-1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aggcagggatattcaccatt
- 3′ sequencing primer aattgtggatgaatactgcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sgRNA targets specific to Panc480 cell line.
Please visit https://doi.org/10.1101/2023.04.15.537042 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiGuide-puro_Panc480-MT7 was a gift from James Eshleman (Addgene plasmid # 200941 ; http://n2t.net/addgene:200941 ; RRID:Addgene_200941) -
For your References section:
CRISPR-Cas9 for selective targeting of somatic mutations in pancreatic cancers. Teh SSK, Bowland K, Halper-Stromberg E, Kotwal A, Bennett A, Skaist A, Tang J, Cai F, Macoretta A, Liang H, Kamiyama H, Wheelan S, Lin MT, Hruban RH, Hung CF, Goldstein M, Scharpf RB, Roberts NJ, Eshleman JR. NAR Cancer. 2024 Jun 19;6(2):zcae028. doi: 10.1093/narcan/zcae028. eCollection 2024 Jun. 10.1093/narcan/zcae028 PubMed 38915758