Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCW57.1-Gata6-3xT7
(Plasmid #200889)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200889 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCW57.1
  • Backbone size w/o insert (bp) 9354
  • Total vector size (bp) 11259
  • Vector type
    Mammalian Expression, Lentiviral ; Doxycycline inducible
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gata6
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1905
  • Promoter TRE promoter, Tet ON
  • Tag / Fusion Protein
    • 3xT7 (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTGCTCCGGTAACAGCAGTG
  • 3′ sequencing primer CCCCTTGAAGGTAGGGCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1-Gata6-3xT7 was a gift from Kai Ge (Addgene plasmid # 200889 ; http://n2t.net/addgene:200889 ; RRID:Addgene_200889)
  • For your References section:

    MLL3/MLL4 methyltransferase activities control early embryonic development and embryonic stem cell differentiation in a lineage-selective manner. Xie G, Lee JE, Senft AD, Park YK, Jang Y, Chakraborty S, Thompson JJ, McKernan K, Liu C, Macfarlan TS, Rocha PP, Peng W, Ge K. Nat Genet. 2023 Apr 3. doi: 10.1038/s41588-023-01356-4. 10.1038/s41588-023-01356-4 PubMed 37012455