Skip to main content
Addgene

Z956
(Bacterial strain #200838)

Print

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 200838 Bacteria in agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    n/a
  • Vector type
    This is a strain, not a plasmid

Growth in Bacteria

  • Bacterial Resistance(s)
    None
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Z956
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Genotype: MG1655 rph+, ilvG+, ΔlacZ, ΔrapZ, ΔglmZ, ΔglmY
  • Species
    Escherichia coli str. K-12 substr. MG1655
  • Mutation
    rapZ, glmZ and glmY are deleted to avoid interference with plasmid-encoded genes

Cloning Information

  • Cloning method Unknown

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Primer to check deletions:
ΔrapZ (5' check primer: GGATACCGAAGGTACTCCGG; 3' check primer: CGTAAGAGCACTTCAGCGTC); ΔglmZ (5' check primer: GTGTAGGATCAAGCTCAGG; 3' check primer: CGGACGCCTACGATTACGC); ΔglmY (5' check primer: GTCTCTTTTTAGCGACACAGTGGC; 3' check primer: GGTGTTACTCTCGTCAGACGCG)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Z956 was a gift from Boris Görke (Addgene plasmid # 200838)

  • For your References section:

    Role of the 5' end phosphorylation state for small RNA stability and target RNA regulation in bacteria. Schilder A, Gorke B. Nucleic Acids Res. 2023 Mar 29:gkad226. doi: 10.1093/nar/gkad226. 10.1093/nar/gkad226 PubMed 36987877
Related items: