pAAV-U6-racRNA-B
(Plasmid #200825)

• Purpose: AAV transfer plasmid encoding a circularized RNA barcode B under U6 promoter and a subcellular localization protein binder under hSyn promoter
• Depositing Lab: Xiao Wang
• Publication: Shi et al Nature. 2023 Oct;622(7983):552-561. doi: 10.1038/s41586-023-06569-5. Epub 2023 Sep 27.

Backbone

• Vector backbone: pAAV-hSyn-mCherry
• Backbone manufacturer: Addgene plasmid #114472
• Backbone size w/o insert (bp): 4537
• Total vector size (bp): 6383
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: U6-racRNA
• Alt name: sequences encoding a circular RNA barcode under U6+27 promoter
• Species: Synthetic
• Insert Size (bp): 614

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GACTATCATATGCTTACCGT

Gene/Insert 2

• Gene/Insert name: V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
• Alt name: V5 tagged PP7 coating protein (PP7cp) fused with mouse HNRNPA1 M9 domain and a nuclear export signal;
• Alt name: Flag tagged PP7 coating protein (PP7cp) fused with farnesylation motif
• Species: M. musculus (mouse), Synthetic
• Insert Size (bp): 1252
• Promoter: hSyn
• Tags / Fusion Proteins:
  • V5 (N terminal on insert)
  • Flag
  • C-Far (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TCGTGTCGTGCCTGAGAGCG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pAAV-U6-racRNA-B.gbk
• A portion of this plasmid was derived from a plasmid made by: Sequences encoding the circular RNA downstream of a U6+27 promoter (U6+27-pre-racRNA) were adopted from the Tornado system (Addgene plasmid #124362, PubMed 30962542).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.06.20.496914v1 for bioRxiv preprint.