Skip to main content
Addgene

CLIPf-KIF5A(1-914; Δ505-610)-SNAPf-HisTag-FLAG
(Plasmid #200793)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200793 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCLAP
  • Backbone size w/o insert (bp) 6558
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KIF5A
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2424
  • Mutation
    1-914; Δ505-610
  • Entrez Gene
    Kif5a (a.k.a. D10Bwg0738e, Khc, Kif5, Kns, mKIAA4086)
  • Promoter CMV & T7
  • Tags / Fusion Proteins
    • CLIPf (N terminal on backbone)
    • SNAPf, HisTag, FLAG (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AGCGAGTCTCACCTGGCC
  • 3′ sequencing primer TGCAGCCAGGTGGCTGTAGGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.12.20.629623 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CLIPf-KIF5A(1-914; Δ505-610)-SNAPf-HisTag-FLAG was a gift from Alison Twelvetrees (Addgene plasmid # 200793 ; http://n2t.net/addgene:200793 ; RRID:Addgene_200793)
  • For your References section:

    Kinesin-1 is highly flexible and adopts an open conformation in the absence of cargo. Smith ER, Turner ED, Abdelhamid MAS, Craggs TD, Twelvetrees AE. bioRxiv 2024.12.20.629623 10.1101/2024.12.20.629623