Skip to main content
Addgene

pJS288
(Plasmid #200714)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200714 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAGT572
  • Backbone manufacturer
    Sylvestre Marillonnet; Alain Tissier
  • Backbone size w/o insert (bp) 5060
  • Total vector size (bp) 8227
  • Vector type
    Yeast Expression, Synthetic Biology
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PMA1 promoter
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1008
  • Mutation
    domesticated for MoClo cloning (removal of internal BpiI or BsaI sites)
  • Entrez Gene
    PMA1 (a.k.a. YGL008C, KTI10)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CCAATCTAAGTCTGTGCTCCTTCC
  • 3′ sequencing primer CTGCCTTTGCTGAGCTGGATC
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Hxt1
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1710
  • GenBank ID
  • Entrez Gene
    HXT1 (a.k.a. YHR094C, HOR4)
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CCAATCTAAGTCTGTGCTCCTTCC
  • 3′ sequencing primer CTGCCTTTGCTGAGCTGGATC
    • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    ADH2 Ter
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    327
  • GenBank ID
    CP020137.1
  • Entrez Gene
    ADH2 (a.k.a. YMR303C, ADR2)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CCAATCTAAGTCTGTGCTCCTTCC
  • 3′ sequencing primer CTGCCTTTGCTGAGCTGGATC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJS288 was a gift from Jens Boch (Addgene plasmid # 200714 ; http://n2t.net/addgene:200714 ; RRID:Addgene_200714)

  • For your References section:

    Functional Analysis of Plant Monosaccharide Transporters Using a Simple Growth Complementation Assay in Yeast. Fuhrmeister R, Streubel J. Bio Protoc. 2023 Aug 5;13(15):e4733. doi: 10.21769/BioProtoc.4733. eCollection 2023 Aug 5. 10.21769/BioProtoc.4733 PubMed 37575400
Related items: