pJS506
(Plasmid #200712)

• Purpose: Promoter region from ATPase PMA1 as Pro5U promoter module for heterologous expression of plasma membrane localized transporters in yeast
• Depositing Lab: Jens Boch
• Publication: Fuhrmeister et al Bio Protoc. 2023 Aug 5;13(15):e4733. doi: 10.21769/BioProtoc.4733. eCollection 2023 Aug 5.

Backbone

• Vector backbone: pICH41295
• Backbone manufacturer: Sylvestre Marillonnet
• Backbone size w/o insert (bp): 2243
• Total vector size (bp): 3251
• Vector type: Synthetic Biology ; Modular cloning

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PMA1 promoter
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1008
• Mutation: domesticated for MoClo cloning (removal of internal BpiI or BsaI sites)
• Entrez Gene: PMA1 (a.k.a. YGL008C, KTI10)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: gctcacatgttctttcctgc
• 3′ sequencing primer: GCC ACC TGA CGT CTA AGA AAC C

Resource Information

• Supplemental Documents:
  • pJS506.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry