Skip to main content
Addgene

pLV-EF1A-CD19.8H.8TM.BB.28.3z
(Plasmid #200673)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200673 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV
  • Backbone manufacturer
    VectorBuilder
  • Backbone size w/o insert (bp) 6451
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FMC63-CD8HD-CD8TM-41BB-CD28-CD3z-P2A-EGFP
  • Alt name
    CD19(FMC63)-CAR, CD8 hinge, CD8 transmembrane, 41BB costim., CD28 costim., CD3z stim domains, P2A-GFP marker
  • Alt name
    Contains: FMC63-scFV, CD8 Hinge domain, CD8-transmembrane domain, 41BB-ITD, CD28-ITD, CD3z-ITD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2466
  • Entrez Gene
    CD8A (a.k.a. CD8, CD8alpha, Leu2, p32)
  • Entrez Gene
    CD28 (a.k.a. Tp44)
  • Entrez Gene
    CD247 (a.k.a. CD3-ZETA, CD3H, CD3Q, CD3Z, CD3ZETA, IMD25, T3Z, TCRZ)
  • Entrez Gene
    TNFRSF9 (a.k.a. 4-1BB, CD137, CDw137, ILA, IMD109)
  • Promoter EF1a-short
  • Tag / Fusion Protein
    • MycTag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgatgtcgtgtactggctcc
  • 3′ sequencing primer tttcttccacgtcgcctgcttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-EF1A-CD19.8H.8TM.BB.28.3z was a gift from Michele Bernasconi (Addgene plasmid # 200673 ; http://n2t.net/addgene:200673 ; RRID:Addgene_200673)
  • For your References section:

    CD276-CAR T cells and Dual-CAR T cells targeting CD276/FGFR4 promote rhabdomyosarcoma clearance in orthotopic mouse models. Timpanaro A, Piccand C, Dzhumashev D, Anton-Joseph S, Robbi A, Moser J, Rossler J, Bernasconi M. J Exp Clin Cancer Res. 2023 Nov 4;42(1):293. doi: 10.1186/s13046-023-02838-3. 10.1186/s13046-023-02838-3 PubMed 37924157