pAAV-hSyn-con/fon DREADD Gi-mCherry
(Plasmid #200660)

• Purpose: Construct for chemogenetically silencing and visualizing subpopulations of neurons in the retina
• Depositing Lab: Samer Hattar
• Publication: Intrsectional chemogenetic viruses for retinal neurobiology (unpublished)

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4600
• Total vector size (bp): 7545
• Vector type: Mammalian Expression, Mouse Targeting, AAV, Cre/Lox ; INTRSECT
• Selectable markers: Beta-lactamase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Growth temperature 32C actual.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DREADD Gi-mCherry
• Alt name: hM4Gi-mCherry
• Species: Synthetic
• Insert Size (bp): 2684
• Promoter: hSyn
• Tag / Fusion Protein:
  • mCherry

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: GTTTAAAGCTCAGGTCGAGA
• 3′ sequencing primer: GAATACCAGTCAATCTTTCAC

Resource Information

• Supplemental Documents:
  • pAAV-hSynINTRSECT-hM4D(Gi)-mCherry.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry