1114H
(Plasmid
#200640)
-
PurposeAn. gambiae transgenesis plasmid. Expresses gRNAs targeting B2-tubulin, ZPG, and DSXF. Crossing to Cas9 generates sterile males
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200640 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBac
-
Backbone manufacturerunknown
-
Modifications to backbonePiggyBac expression casette added
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting DSXF, ZPG, and B2-tubulin. Actin5c-CFP and Vasa2-EYFP reporters.
-
gRNA/shRNA sequenceGATCCGATCACGCAGTCGAT, GCTCGATATCGTGCGCAAGG, CCAAATAGGCGCTAAGTTCT, TTATCATCCACTCTGACGGG, GTTTAACACAGGTCAAGCGG
-
SpeciesAn. gambiae
-
GenBank IDAGAP006241
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- 3′ sequencing primer CTTGGAGCTCCCGTGAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1114H was a gift from Omar Akbari (Addgene plasmid # 200640 ; http://n2t.net/addgene:200640 ; RRID:Addgene_200640) -
For your References section:
Eliminating Malaria Vectors with Precision Guided Sterile Males. Smidler AL, Apte RA, Pai JJ, Chow ML, Chen S, Mondal A, Sanchez C HM, Antoshechkin I, Marshall JM, Akbari OS. bioRxiv [Preprint]. 2023 Jul 21:2023.07.20.549947. doi: 10.1101/2023.07.20.549947. 10.1101/2023.07.20.549947 PubMed 37503146