Skip to main content
Addgene

pAAV-Tbg-CES2C-ΔC
(Plasmid #200559)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200559 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV-TBG
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mouse Carboxylesterase 2C delta C-terminal
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ces2c (a.k.a. ACH M1, CES 2, Ces2, ces2A3)
  • Promoter TBG promoter
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer aaactgggcttgtcgagaca
  • 3′ sequencing primer gcagcgtatccacatag
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Tbg-CES2C-ΔC was a gift from Jonathan Long (Addgene plasmid # 200559 ; http://n2t.net/addgene:200559 ; RRID:Addgene_200559)

  • For your References section:

    Organism-wide, cell-type-specific secretome mapping of exercise training in mice. Wei W, Riley NM, Lyu X, Shen X, Guo J, Raun SH, Zhao M, Moya-Garzon MD, Basu H, Sheng-Hwa Tung A, Li VL, Huang W, Wiggenhorn AL, Svensson KJ, Snyder MP, Bertozzi CR, Long JZ. Cell Metab. 2023 Apr 28:S1550-4131(23)00138-9. doi: 10.1016/j.cmet.2023.04.011. 10.1016/j.cmet.2023.04.011 PubMed 37141889
Related items:
Commonly requested with: