Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKLV2-U6gRNA5(SMARCA2(47))-PGKpuro2ABFP-W
(Plasmid #200510)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 200510 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W
  • Backbone manufacturer
    addgene
  • Backbone size w/o insert (bp) 8648
  • Total vector size (bp) 8650
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SMARCA2(47)
  • gRNA/shRNA sequence
    TTGTCCCCCAGCTACGGAG
  • Species
    H. sapiens (human)
  • Entrez Gene
    SMARCA2 (a.k.a. BAF190, BIS, BRM, NCBRS, SNF2, SNF2L2, SNF2LA, SWI2, Sth1p, hBRM, hSNF2a)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer AGATAATTAGAATTAATTTGACTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV2-U6gRNA5(SMARCA2(47))-PGKpuro2ABFP-W was a gift from Kosuke Yusa (Addgene plasmid # 200510 ; http://n2t.net/addgene:200510 ; RRID:Addgene_200510)
  • For your References section:

    Canonical BAF complex regulates the oncogenic program in human T-cell acute lymphoblastic leukemia. Aoki K, Hyuga M, Tarumoto Y, Nishibuchi G, Ueda A, Ochi Y, Sugino S, Mikami T, Kobushi H, Kato I, Akahane K, Inukai T, Takaori-Kondo A, Takita J, Ogawa S, Yusa K. Blood. 2023 Nov 3:blood.2023020857. doi: 10.1182/blood.2023020857. 10.1182/blood.2023020857 PubMed 37922452