All-in-one lenti-evoCDA-NG
(Plasmid #200449)

• Purpose: (Empty Backbone) Lentivirus vector for base editing
• Depositing Lab: Benjamin Cravatt
• Publication: Li et al Nat Chem Biol. 2023 Nov;19(11):1320-1330. doi: 10.1038/s41589-023-01428-w. Epub 2023 Oct 2.

Backbone

• Vector backbone: lentiCRISPR v2
• Modifications to backbone: Inserted base editor (#125613) to lentivirus plasmid #52961.
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GACTATCATATGCTTACCGT

Resource Information

• Supplemental Documents:
  • All-in-one lenti-evoCDA-NG.gb
• A portion of this plasmid was derived from a plasmid made by: Base editor (#125613, gift from David Liu, Broad Institute) was inserted into lentivirus plasmid (#52961, gift from Feng Zhang, Broad Institute).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.11.17.516964v1 for bioRxiv preprint.