Flag-ciBAR1
(Plasmid
#200440)
-
PurposeExpresses Flag-tagged human ciBAR1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200440 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCD-betaG-FLAG
- Backbone size w/o insert (bp) 4118
- Total vector size (bp) 4988
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameciBAR1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)870
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GCGTGCCTAATGGGAGGTCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-ciBAR1 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 200440 ; http://n2t.net/addgene:200440 ; RRID:Addgene_200440) -
For your References section:
BAR Domain-Containing FAM92 Proteins Interact with Chibby1 To Facilitate Ciliogenesis. Li FQ, Chen X, Fisher C, Siller SS, Zelikman K, Kuriyama R, Takemaru KI. Mol Cell Biol. 2016 Oct 13;36(21):2668-2680. doi: 10.1128/MCB.00160-16. Print 2016 Nov 1. 10.1128/MCB.00160-16 PubMed 27528616