pDV24_AAV2_DART-VADAR_iRFP720-sensor
(Plasmid
#200411)
-
PurposeAAV vector encoding a DART-VADAR sensor for iRFP720 mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200411 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneCustom
-
Vector typeMammalian Expression, AAV, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDART VADAR sensor
-
SpeciesSynthetic
- Promoter CMV
-
Tags
/ Fusion Proteins
- TagBFP (N terminal on backbone)
- mNeonGreen (C terminal on backbone)
- MCP-ADAR2dd(E488Q)-NES (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGGGCCAGGATTCTCTTCGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Prone to recombination. This DART VADAR sensor detects the iRFP720 transcript (pDV5.x)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDV24_AAV2_DART-VADAR_iRFP720-sensor was a gift from James Collins (Addgene plasmid # 200411 ; http://n2t.net/addgene:200411 ; RRID:Addgene_200411) -
For your References section:
Autocatalytic base editing for RNA-responsive translational control. Gayet RV, Ilia K, Razavi S, Tippens ND, Lalwani MA, Zhang K, Chen JX, Chen JC, Vargas-Asencio J, Collins JJ. Nat Commun. 2023 Mar 11;14(1):1339. doi: 10.1038/s41467-023-36851-z. 10.1038/s41467-023-36851-z PubMed 36906659