pDV21_feedback_entry_TagBFP-2A-MCS-2A-NLuc-2A-MCP-ADAR2dd(E488Q)-NES
(Plasmid
#200403)
-
PurposeEntry vector for closed-loop ADAR-based RNA sensors (DART VADAR). Expresses TagBFP constitutively. Expresses NanoLuc and MCP-ADAR upon target detection
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneCustom
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameClosed-loop DART VADAR sensor entry cassette
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tggacaccatggtacctgggc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDV21_feedback_entry_TagBFP-2A-MCS-2A-NLuc-2A-MCP-ADAR2dd(E488Q)-NES was a gift from James Collins (Addgene plasmid # 200403 ; http://n2t.net/addgene:200403 ; RRID:Addgene_200403) -
For your References section:
Autocatalytic base editing for RNA-responsive translational control. Gayet RV, Ilia K, Razavi S, Tippens ND, Lalwani MA, Zhang K, Chen JX, Chen JC, Vargas-Asencio J, Collins JJ. Nat Commun. 2023 Mar 11;14(1):1339. doi: 10.1038/s41467-023-36851-z. 10.1038/s41467-023-36851-z PubMed 36906659
