Skip to main content
Addgene

pBAC-ie1-DsRed-ObirOrco-QF2-15xQUAS-GCaMP6s
(Plasmid #200400)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200400 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pXL-BACII-DsRed
  • Backbone manufacturer
    Potter Lab
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 12025
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Discosoma red fluorescent protein
  • Alt name
    DsRed
  • Species
    Discosoma sp.
  • Insert Size (bp)
    678
  • Promoter ie1 (baculovirus)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTGCAGAACACGCAGCTAG
  • 3′ sequencing primer CCCTCCATGCGCACCTT
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Q factor 2
  • Alt name
    QF2
  • Species
    Neurospora crassa
  • Insert Size (bp)
    1056
  • Promoter ObirOrco (Oocearaea biroi Orco promoter/enhancer fragment)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATGCAGAAGAAGACCATG
  • 3′ sequencing primer CCTGATAAGTGCAGGAC
    • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    GCaMP6s
  • Alt name
    GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
  • Alt name
    GCaMP3 variant 641
  • Species
    R. norvegicus (rat), G. gallus (chicken); ; A. victoria (jellyfish)
  • Insert Size (bp)
    1353
  • Promoter 15x QUAS

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTAAACAATCTGCAGTAAAG
  • 3′ sequencing primer CATGTTCTACTTACGTGATAAC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ie1 was cloned from Zach Adelman (Addgene #52894); DsRed & QF2 from Chris Potter (Addgene #104877); 15xQUAS from Chris Potter (Addgene #104875); GCaMP6s from Douglas Kim and GENIE Project (Addgene #40753)
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAC-ie1-DsRed-ObirOrco-QF2-15xQUAS-GCaMP6s was a gift from Daniel Kronauer (Addgene plasmid # 200400 ; http://n2t.net/addgene:200400 ; RRID:Addgene_200400)

  • For your References section:

    Sparse and stereotyped encoding implicates a core glomerulus for ant alarm behavior. Hart T, Frank DD, Lopes LE, Olivos-Cisneros L, Lacy KD, Trible W, Ritger A, Valdes-Rodriguez S, Kronauer DJC. Cell. 2023 Jul 6;186(14):3079-3094.e17. doi: 10.1016/j.cell.2023.05.025. Epub 2023 Jun 14. 10.1016/j.cell.2023.05.025 PubMed 37321218
Related items:
Commonly requested with: