pAAV-ZnF-hSyn-DIO-GPHNFingR-eGFP
(Plasmid
#200279)
-
PurposeGenetically encoded fluorescent probe for labelling endogenous inhibitory synapses in vivo
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200279 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namezFn-FingR-GPHN-eGFP
-
SpeciesM. musculus (mouse)
- Promoter human Synapsin
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SgsI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byOriginal clone was obtained from plasmid #46296.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.03.11.532164 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-ZnF-hSyn-DIO-GPHNFingR-eGFP was a gift from Peter Scheiffele (Addgene plasmid # 200279 ; http://n2t.net/addgene:200279 ; RRID:Addgene_200279) -
For your References section:
Control of neuronal excitation-inhibition balance by BMP-SMAD1 signaling. Okur Z, Schlauri N, Bitsikas V, Panopoulou M, Karmakar K, Schreiner D, Scheiffele P. bioRxiv 2023 10.1101/2023.03.11.532164