Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1-VinculinI997A_TurboID_Venus
(Plasmid #200274)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200274 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5380
  • Total vector size (bp) 10280
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VinculinI997A_TurboID_Venus
  • Alt name
    VinI997A-TurboID-Ven
  • Species
    G. gallus (chicken), Synthetic
  • Insert Size (bp)
    4900
  • Mutation
    change isoleucine to alanine at 997 of vinculin
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GTAAACGGCCACAAGTTCAGC
  • 3′ sequencing primer GACGTAGCCTTCGGGCAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-VinculinI997A_TurboID_Venus was a gift from Brenton Hoffman (Addgene plasmid # 200274 ; http://n2t.net/addgene:200274 ; RRID:Addgene_200274)
  • For your References section:

    Identifying constitutive and context-specific molecular-tension-sensitive protein recruitment within focal adhesions. Tao A, LaCroix AS, Shoyer TC, Venkatraman V, Xu KL, Feiger B, Hoffman BD. Dev Cell. 2023 Mar 10:S1534-5807(23)00074-6. doi: 10.1016/j.devcel.2023.02.015. 10.1016/j.devcel.2023.02.015 PubMed 36924770