Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXY349
(Plasmid #200262)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200262 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pIQ
  • Backbone size w/o insert (bp) 4674
  • Total vector size (bp) 6693
  • Modifications to backbone
    modify the −35 region of the lacIQ promoter from GTGCAA to TTGACA.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FtsW-tagRFP
  • Insert Size (bp)
    2019
  • Entrez Gene
    ftsW (a.k.a. b0089, ECK0090)
  • Promoter LacI
  • Tag / Fusion Protein
    • tagRFP (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ctttcgtcttcacctcgagaaatc
  • 3′ sequencing primer gctaattaagcttggctgcaggt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXY349 was a gift from Jie Xiao (Addgene plasmid # 200262 ; http://n2t.net/addgene:200262 ; RRID:Addgene_200262)
  • For your References section:

    A two-track model for the spatiotemporal coordination of bacterial septal cell wall synthesis revealed by single-molecule imaging of FtsW. Yang X, McQuillen R, Lyu Z, Phillips-Mason P, De La Cruz A, McCausland JW, Liang H, DeMeester KE, Santiago CC, Grimes CL, de Boer P, Xiao J. Nat Microbiol. 2021 May;6(5):584-593. doi: 10.1038/s41564-020-00853-0. Epub 2021 Jan 25. 10.1038/s41564-020-00853-0 PubMed 33495624
Commonly requested with: