2333_Cas9-CtIP-dnRNF168
(Plasmid
#200254)
-
PurposeThis plasmid expresses the Cas9-CtIP-dnRNF168 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200254 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPIX
- Backbone size w/o insert (bp) 3197
- Total vector size (bp) 7214
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9-CtIP-dnRNF168
-
SpeciesH. sapiens (human); Streptococcus pyogenes
-
Insert Size (bp)8661
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCCACTTTGCCTTTCTCTCCACAGG
- 3′ sequencing primer cctcgactgtgccttcta (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
2333_Cas9-CtIP-dnRNF168 was a gift from Claudio Mussolino (Addgene plasmid # 200254 ; http://n2t.net/addgene:200254 ; RRID:Addgene_200254) -
For your References section:
A novel Cas9 fusion protein promotes targeted genome editing with reduced mutational burden in primary human cells. Carusillo A, Haider S, Schafer R, Rhiel M, Turk D, Chmielewski KO, Klermund J, Mosti L, Andrieux G, Schafer R, Cornu TI, Cathomen T, Mussolino C. Nucleic Acids Res. 2023 May 22;51(9):4660-4673. doi: 10.1093/nar/gkad255. 10.1093/nar/gkad255 PubMed 37070192