OA-1055J
(Plasmid
#200251)
-
PurposepBac-U6-gRNA(Intersex)-3xp3-tdTomato
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepiggyBac
- Backbone size w/o insert (bp) 7153
- Total vector size (bp) 10398
-
Vector typeInsect Expression
-
Selectable markerstdTomato
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2 gRNAs targeting Intersex gene
-
gRNA/shRNA sequencegcgggattcgctctcgacga, ggacaacatttccaaggtta
-
SpeciesAedes aegypti
-
Insert Size (bp)8309
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.04.18.537404 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OA-1055J was a gift from Omar Akbari (Addgene plasmid # 200251 ; http://n2t.net/addgene:200251 ; RRID:Addgene_200251) -
For your References section:
Targeting Sex Determination to Suppress Mosquito Populations. Li M, Kandul NP, Sun R, Yang T, Benetta ED, Brogan DJ, Antoshechkin I, Sanchez C HM, Zhan Y, DeBeaubien NA, Loh YM, Su MP, Montell C, Marshall JM, Akbari OS. bioRxiv. 2023 Nov 15:2023.04.18.537404. doi: 10.1101/2023.04.18.537404. Preprint. 10.1101/2023.04.18.537404 PubMed 37131747