Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

OA-1055J
(Plasmid #200251)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200251 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    piggyBac
  • Backbone size w/o insert (bp) 7153
  • Total vector size (bp) 10398
  • Vector type
    Insect Expression
  • Selectable markers
    tdTomato

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    2 gRNAs targeting Intersex gene
  • gRNA/shRNA sequence
    gcgggattcgctctcgacga, ggacaacatttccaaggtta
  • Species
    Aedes aegypti
  • Insert Size (bp)
    8309

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.04.18.537404 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    OA-1055J was a gift from Omar Akbari (Addgene plasmid # 200251 ; http://n2t.net/addgene:200251 ; RRID:Addgene_200251)
  • For your References section:

    Targeting Sex Determination to Suppress Mosquito Populations. Li M, Kandul NP, Sun R, Yang T, Benetta ED, Brogan DJ, Antoshechkin I, Sanchez C HM, Zhan Y, DeBeaubien NA, Loh YM, Su MP, Montell C, Marshall JM, Akbari OS. bioRxiv. 2023 Nov 15:2023.04.18.537404. doi: 10.1101/2023.04.18.537404. Preprint. 10.1101/2023.04.18.537404 PubMed 37131747