Skip to main content
Addgene

mAMCase_CatD_6xHis_pTwistCMV
(Plasmid #200228)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200228 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTwist CMV
  • Backbone size w/o insert (bp) 4197
  • Total vector size (bp) 5391
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Acidic Mammalian Chitinase
  • Alt name
    mAMCase
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1173
  • Mutation
    S354F
  • GenBank ID
    NC_000069.7
  • Entrez Gene
    Chia1 (a.k.a. 2200003E03Rik, AMCase, Chia, YNL)
  • Promoter CMV
  • Tag / Fusion Protein
    • 6xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CAGAGCTGGTTTAGTGAACC
  • 3′ sequencing primer TCATGTCTGTGAGCTGAAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Twist Biosciences
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.06.03.542675 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mAMCase_CatD_6xHis_pTwistCMV was a gift from James S Fraser (Addgene plasmid # 200228 ; http://n2t.net/addgene:200228 ; RRID:Addgene_200228)
  • For your References section:

    Structural characterization of ligand binding and pH-specific enzymatic activity of mouse Acidic Mammalian Chitinase. Diaz RE, Ecker AK, Correy GJ, Asthana P, Young ID, Faust B, Thompson MC, Seiple IB, Van Dyken S, Locksley RM, Fraser JS. Elife. 2024 Jun 17;12:RP89918. doi: 10.7554/eLife.89918. 10.7554/eLife.89918 PubMed 38884443