Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TBPL1 KO 2
(Plasmid #200211)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200211 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TBP1 KO 2
  • gRNA/shRNA sequence
    gcaggtctcaaacggtgctc
  • Species
    M. musculus (mouse)
  • Mutation
    None
  • Entrez Gene
    Tbpl1 (a.k.a. 4732475G08, STD, TLF, TRF2, TRP, Tlp)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TBPL1 KO 2 was a gift from Sheila Teves (Addgene plasmid # 200211 ; http://n2t.net/addgene:200211 ; RRID:Addgene_200211)
  • For your References section:

    RNA Polymerase II transcription independent of TBP in murine embryonic stem cells. Kwan JZJ, Nguyen TF, Uzozie AC, Budzynski MA, Cui J, Lee JMC, Van Petegem F, Lange PF, Teves SS. Elife. 2023 Mar 30;12:e83810. doi: 10.7554/eLife.83810. 10.7554/eLife.83810 PubMed 36995326