TBPL1 KO 1
(Plasmid
#200210)
-
PurposegRNA for TBPL1 KO
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTBP1 KO 1
-
gRNA/shRNA sequenceatcactgtctgcatccattg
-
SpeciesM. musculus (mouse)
-
MutationNone
-
Entrez GeneTbpl1 (a.k.a. 4732475G08, STD, TLF, TRF2, TRP, Tlp)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.05.511012v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TBPL1 KO 1 was a gift from Sheila Teves (Addgene plasmid # 200210 ; http://n2t.net/addgene:200210 ; RRID:Addgene_200210) -
For your References section:
RNA Polymerase II transcription independent of TBP in murine embryonic stem cells. Kwan JZJ, Nguyen TF, Uzozie AC, Budzynski MA, Cui J, Lee JMC, Van Petegem F, Lange PF, Teves SS. Elife. 2023 Mar 30;12:e83810. doi: 10.7554/eLife.83810. 10.7554/eLife.83810 PubMed 36995326