UbC-blasticidine-P2A-TETon-3G transactivator
(Plasmid #200191)

• Purpose: A TETon activator, which combined with the DiLiCre 2.0 plasmid, drives the expression of DiLiCre 2.0 upon doxycycline. DiLiCre 2.0 is a cre recombinase that is activated by violet light.
• Depositing Lab: Jacco van Rheenen
• Publication: Vizoso et al Nat Commun. 2022 Oct 28;13(1):6442. doi: 10.1038/s41467-022-33863-z.

Backbone

• Vector backbone: #71666 pdCas9-DNMT3A-EGFP
• Backbone manufacturer: Vlatka Zoldos
• Backbone size w/o insert (bp): 8020
• Total vector size (bp): 10400
• Vector type: Mammalian Expression, Bacterial Expression, Lentiviral
• Selectable markers: Zeocin ; Bleomycin, Phleomycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: blasticidine - P2A - TETon-3G transactivator
• Species: Synthetic
• Insert Size (bp): 2449
• GenBank ID:
• Promoter: UbC

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GAAGAGGTACACCAGCACCAAAG 3
• 3′ sequencing primer: cgaggtcgacggtatcg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Backbone from pdCas9-DNMT3A-EGFP (Vlatka Zoldoš), P2A linker and a TETon3G fragment from pCAG-TetON-3G (Elena Cattaneo). For more information, see comments.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A lentiviral UbC-blasticidine-P2A-TETon-3G transactivator vector was synthesized using the #71666 pdCas9-DNMT3A-EGFP vector backbone digested with NheI-EcoRI and ligated to the following DNA fragments: UbC promoter and blasticidine cassette amplified and fused by PCR using 40–50 bp internal overlapping primers and one external reverse primer containing a P2A linker, and a TETon-3G fragment amplified from the Addgene vector #96963 pCAG-TetON-3G using a forward primer containing a P2A sequence so it could be fused to the UbC-Blasticidin-P2A sequence during a last round PCR amplification with NheI and EcoRI external primers.