pSEMS-Tom20-mEGFP-reHaloTagS
(Plasmid #200189)

• Purpose: Tom20 with reversible HaloTagS variant for fluorescent labeling
• Depositing Lab: Jacob Piehler
• Publication: Holtmannspotter et al Angew Chem Int Ed Engl. 2023 Feb 3:e202219050. doi: 10.1002/anie.202219050.

Backbone

• Vector backbone: pSEMS(26m)
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tom20
• Species: H. sapiens (human)
• Insert Size (bp): 435
• Entrez Gene: TOMM20 (a.k.a. MAS20, MOM19, TOM20)
• Promoter: CMV
• Tags / Fusion Proteins:
  • mEGFP (C terminal on insert)
  • reHaloTagS (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: ATGGTGGGTCGGAACAGCGCCAT
• 3′ sequencing primer: TTCCACATCATCTTCAGCCAAG

Resource Information

• Supplemental Documents:
  • pSems-Tom20-mEGFP-link-reHaloTagS.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry