Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV9-null
(Plasmid #200182)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200182 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMCV
  • Backbone size w/o insert (bp) 1799
  • Total vector size (bp) 6087
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAV9 Cap w/ nonsense mutation at VR8
  • Species
    Synthetic
  • Insert Size (bp)
    2210
  • Mutation
    Replaced amino acids 586-592 in Cap with nonsense mutation

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TCATGGGAAAGGTGCCAGAC
  • 3′ sequencing primer cctctgacttgagcgtcgattt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV9-null was a gift from Aravind Asokan (Addgene plasmid # 200182 ; http://n2t.net/addgene:200182 ; RRID:Addgene_200182)
  • For your References section:

    Structure-guided AAV capsid evolution strategies for enhanced CNS gene delivery. Gonzalez TJ, Mitchell-Dick A, Blondel LO, Fanous MM, Hull JA, Oh DK, Moller-Tank S, Castellanos Rivera RM, Piedrahita JA, Asokan A. Nat Protoc. 2023 Sep 21. doi: 10.1038/s41596-023-00875-y. 10.1038/s41596-023-00875-y PubMed 37735235