Skip to main content
Addgene

pAAV9-null
(Plasmid #200182)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200182 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMCV
  • Backbone size w/o insert (bp) 1799
  • Total vector size (bp) 6087
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAV9 Cap w/ nonsense mutation at VR8
  • Species
    Synthetic
  • Insert Size (bp)
    2210
  • Mutation
    Replaced amino acids 586-592 in Cap with nonsense mutation

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TCATGGGAAAGGTGCCAGAC
  • 3′ sequencing primer cctctgacttgagcgtcgattt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV9-null was a gift from Aravind Asokan (Addgene plasmid # 200182 ; http://n2t.net/addgene:200182 ; RRID:Addgene_200182)
  • For your References section:

    Structure-guided AAV capsid evolution strategies for enhanced CNS gene delivery. Gonzalez TJ, Mitchell-Dick A, Blondel LO, Fanous MM, Hull JA, Oh DK, Moller-Tank S, Castellanos Rivera RM, Piedrahita JA, Asokan A. Nat Protoc. 2023 Sep 21. doi: 10.1038/s41596-023-00875-y. 10.1038/s41596-023-00875-y PubMed 37735235