pAAV9-null
(Plasmid #200182)

• Purpose: Expresses AAV2 Rep and AAV9 Cap with nonsense mutation at VR8 site
• Depositing Lab: Aravind Asokan
• Publication: Gonzalez et al Nat Protoc. 2023 Sep 21. doi: 10.1038/s41596-023-00875-y.

Backbone

• Vector backbone: pMCV
• Backbone size w/o insert (bp): 1799
• Total vector size (bp): 6087
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AAV9 Cap w/ nonsense mutation at VR8
• Species: Synthetic
• Insert Size (bp): 2210
• Mutation: Replaced amino acids 586-592 in Cap with nonsense mutation

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TCATGGGAAAGGTGCCAGAC
• 3′ sequencing primer: cctctgacttgagcgtcgattt

Resource Information

• Supplemental Documents:
  • pAAV9-null.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry