pJL1_CSL3
(Plasmid
#200173)
-
PurposeAmino acids 1-195 of CSL3 with an N-terminal 6xHis-tag followed by a TEV site in the pJL1 vector
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200173 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepJL1
- Backbone size w/o insert (bp) 1763
- Total vector size (bp) 2426
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCSL3
-
Insert Size (bp)663
- Promoter T7
-
Tags
/ Fusion Proteins
- 6x His tag (N terminal on insert)
- TEV cleavage site (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL1_CSL3 was a gift from Michael Jewett (Addgene plasmid # 200173 ; http://n2t.net/addgene:200173 ; RRID:Addgene_200173) -
For your References section:
Cell-free expression and characterization of multivalent rhamnose-binding lectins using biolayer interferometry. Warfel KF, Laigre E, Sobol SE, Gillon E, Varrot A, Renaudet O, Dejeu J, Jewett MC, Imberty A. Glycobiology. 2023 Mar 7:cwad018. doi: 10.1093/glycob/cwad018. 10.1093/glycob/cwad018 PubMed 36882003
