pJH4316
(Plasmid
#200171)
-
PurposePflp-18 LoxP EBFP (stop) LoxP twk-40(gf) GFP unc-54 3' UTR C.elegans AVA and other neurons expression of twk-40(gf) GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200171 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepBSK
-
Backbone manufacturerstratagene
- Backbone size w/o insert (bp) 7189
- Total vector size (bp) 9232
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametwk-40
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)2043
-
Entrez Genetwk-40 (a.k.a. CELE_T28A8.1)
- Promoter Pflp-18
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTATAGCATACATTATACGAAGTTATgctagcatggcaacatggaaaacctacgcccggat
- 3′ sequencing primer agtgaaaagttcttctcctttactcataacatgaacttcttgagttcttccagtgaga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH4316 was a gift from Mei Zhen (Addgene plasmid # 200171 ; http://n2t.net/addgene:200171 ; RRID:Addgene_200171) -
For your References section:
A tonically active master neuron modulates mutually exclusive motor states at two timescales. Meng J, Ahamed T, Yu B, Hung W, Ei Mouridi S, Wang Z, Zhang Y, Wen Q, Boulin T, Gao S, Zhen M. Sci Adv. 2024 Apr 12;10(15):eadk0002. doi: 10.1126/sciadv.adk0002. Epub 2024 Apr 10. 10.1126/sciadv.adk0002 PubMed 38598630