pET-APOBEC1-YTH
(Plasmid
#200158)
-
PurposeFor bacterial expression of the APOBEC1-YTH fusion protein for protein purification
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200158 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET His6 MBP TEV LIC cloning vector
-
Backbone manufacturerScott Gradia
- Backbone size w/o insert (bp) 6400
- Total vector size (bp) 7800
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAPOBEC1-YTH
-
SpeciesH. sapiens (human), R. norvegicus (rat)
-
MutationCodon optimized for E coli expression
- Promoter LacZ
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- 6xHis (N terminal on insert)
- Maltose Binding Protein (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer atgagctcagagactggcccagtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-APOBEC1-YTH was a gift from Kate Meyer (Addgene plasmid # 200158 ; http://n2t.net/addgene:200158 ; RRID:Addgene_200158) -
For your References section:
Improved Methods for Deamination-Based m(6)A Detection. Zhu H, Yin X, Holley CL, Meyer KD. Front Cell Dev Biol. 2022 Apr 27;10:888279. doi: 10.3389/fcell.2022.888279. eCollection 2022. 10.3389/fcell.2022.888279 PubMed 35573664