WT GLUT1-GFP
(Plasmid #200093)

• Purpose: WT human GLUT1 with a C-terminal GFP tag in pQCXIP vector
• Depositing Lab: Jason MacGurn
• Publication: Qualls-Histed et al iScience. 2023 Feb 6;26(3):106150. doi: 10.1016/j.isci.2023.106150. eCollection 2023 Mar 17.

Backbone

• Vector backbone: pQCXIP
• Backbone manufacturer: ClonTech
• Backbone size w/o insert (bp): 7400
• Total vector size (bp): 9409
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GLUT1
• Species: H. sapiens (human)
• Insert Size (bp): 2245
• GenBank ID: NM_006516.4
• Entrez Gene: SLC2A1 (a.k.a. CSE, DYT17, DYT18, DYT9, EIG12, GLUT, GLUT-1, GLUT1, GLUT1DS, HTLVR, PED, SDCHCN)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: AACCGTCAGATCGCCTGGAG

Resource Information

• Supplemental Documents:
  • WT GLUT1-GFP.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry