Skip to main content
Addgene

GfaABC1D-Crym-eGFP
(Plasmid #200080)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200080 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PZac2.1
  • Backbone size w/o insert (bp) 3307
  • Total vector size (bp) 6784
  • Vector type
    Mouse Targeting, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GfaABC1D-Crym-eGFP
  • Species
    M. musculus (mouse)
  • Promoter GfaABC1D
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (destroyed during cloning)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer ctcaagcttcgaattatgaagcgggcgccagcg
  • 3′ sequencing primer gattcttggtcatctggcaaggatccaccggtcgcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GfaABC1D-Crym-eGFP was a gift from Baljit Khakh (Addgene plasmid # 200080 ; http://n2t.net/addgene:200080 ; RRID:Addgene_200080)
  • For your References section:

    Crym-positive striatal astrocytes gate perseverative behaviour. Ollivier M, Soto JS, Linker KE, Moye SL, Jami-Alahmadi Y, Jones AE, Divakaruni AS, Kawaguchi R, Wohlschlegel JA, Khakh BS. Nature. 2024 Mar;627(8003):358-366. doi: 10.1038/s41586-024-07138-0. Epub 2024 Feb 28. 10.1038/s41586-024-07138-0 PubMed 38418885