pTHY_P0030_T2c_BCD_25K
(Plasmid
#200045)
-
PurposeBicistronic RBS 25K Part
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200045 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC
- Total vector size (bp) 3278
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBCD 25K
-
SpeciesSynthetic
-
Insert Size (bp)166
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer acagggctataaggtagatccggg
- 3′ sequencing primer ctcttttctggaatttggtaccgagggtgacttc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid encodes a part for use in a heirarchical golden gate plasmid assembly system. The part insert is a bicistronic translational control element for regulating translation of protein-coding genes in E. coli. It is flanked by sites for the type IIS restriction enzyme BsaI and yields 5' and 3' overhangs of GGAG and TATG respectively. The backbone contains a pUC origin, a TEM-1 ampicillin resistance marker, and a ccdB marker such that the part plasmid does not carry through into higher order plasmid assemblies. The plasmid must be propagated in an E. coli strain which is resistant to ccdB.
Please visit https://www.biorxiv.org/content/10.1101/2023.02.09.527918v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTHY_P0030_T2c_BCD_25K was a gift from Ross Thyer (Addgene plasmid # 200045 ; http://n2t.net/addgene:200045 ; RRID:Addgene_200045) -
For your References section:
Interrogating the Function of Bicistronic Translational Control Elements to Improve Consistency of Gene Expression. Jansen Z, Reilly SR, Lieber-Kotz M, Li AZ, Wei Q, Kulhanek DL, Gilmour AR, Thyer R. ACS Synth Biol. 2023 Jun 16;12(6):1608-1615. doi: 10.1021/acssynbio.3c00093. Epub 2023 May 30. 10.1021/acssynbio.3c00093 PubMed 37253269