Skip to main content
Addgene

pCMV-eGFP-mPlum-HA
(Plasmid #200009)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200009 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCMV-Green Renilla Luc
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 7185
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP, mPlum
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer Pause_for CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer AmpR_rev GGTGCCTCACTGATTAAGCATTGGT
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-eGFP-mPlum-HA was a gift from Thomas Noll (Addgene plasmid # 200009 ; http://n2t.net/addgene:200009 ; RRID:Addgene_200009)

  • For your References section:

    Enhancing stability of recombinant CHO cells by CRISPR/Cas9-mediated site-specific integration into regions with distinct histone modifications. Hertel O, Neuss A, Busche T, Brandt D, Kalinowski J, Bahnemann J, Noll T. Front Bioeng Biotechnol. 2022 Oct 13;10:1010719. doi: 10.3389/fbioe.2022.1010719. eCollection 2022. 10.3389/fbioe.2022.1010719 PubMed 36312557
Related items: