Skip to main content
Addgene

pCRISPRi
(Plasmid #199808)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199808 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCN50
  • Backbone size w/o insert (bp) 5750
  • Modifications to backbone
    Site directed mutagenesis to remove BSAI site in AmpR gene. Replacement of the temperature sensitive S. aureus pT181cop-634 replicon with the wild type pT181 replicon. Vector modified to carry dead Cas9, and an sgRNA cassette. sgRNA has a GFP-expression construct cloned into its BSAI site to facilitate screening for successful cloning of targeting constructs (successful cloning events excise the GFP and colonies do not fluoresce) .
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Chloramphenicol selection in S. aureus, Ampicillin selection in E. coli. Temperature sensitive replicon must be maintained at 32 degrees in S. aureus. Stable at 37 degrees in E. coli.
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    dCas9
  • Insert Size (bp)
    4297
  • Promoter P23

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SbfI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer AAACCTGCAGGGCTGGCGGCCGCTGCATGatgacaaaaagagcaaaattttgataaaatagtattagTCGACAAAGGAGGCAAAAATGG
  • 3′ sequencing primer AAACCCGGGagtcttgaaaagcccctgtattact
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    sgRNA with GFP cassette
  • Species
    Synthetic
  • Insert Size (bp)
    1519
  • Promoter PRAB17 (sgRNA) and SarAP1 (GFP)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site KasI (not destroyed)
  • 3′ cloning site KasI (not destroyed)
  • 5′ sequencing primer AAAAATATGAACactctatcattg
  • 3′ sequencing primer CGGTGCCACTTTTTCAAGTT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See source publication for detailed protocols describing this vector's use.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPRi was a gift from Steve Salipante (Addgene plasmid # 199808 ; http://n2t.net/addgene:199808 ; RRID:Addgene_199808)

  • For your References section:

    Clinical and in vitro models identify distinct adaptations enhancing Staphylococcus aureus pathogenesis in human macrophages. Long DR, Holmes EA, Lo HY, Penewit K, Almazan J, Hodgson T, Berger NF, Bishop ZH, Lewis JD, Waalkes A, Wolter DJ, Salipante SJ. PLoS Pathog. 2024 Jul 11;20(7):e1012394. doi: 10.1371/journal.ppat.1012394. eCollection 2024 Jul. 10.1371/journal.ppat.1012394 PubMed 38991026
Related items:
Commonly requested with: