PGK-EGFP-FKBPF36V
(Plasmid
#199765)
-
Purposeplasmid for targeting dTAG into the AAVS1 locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199765 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAVS1-hPGK-Blast
- Backbone size w/o insert (bp) 4814
- Total vector size (bp) 5936
-
Vector typeMammalian Expression, Worm Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-dTAG
-
Insert Size (bp)1089
- Promoter hPGK
-
Tag
/ Fusion Protein
- GFP and dTAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGAAACAGCTATGAC
- 3′ sequencing primer gagaggtcggtgattcggtc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.01.24.525327v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGK-EGFP-FKBPF36V was a gift from Hannes Lans (Addgene plasmid # 199765 ; http://n2t.net/addgene:199765 ; RRID:Addgene_199765) -
For your References section:
Recovery of protein synthesis to assay DNA repair activity in transcribed genes in living cells and tissues. van der Woude M, Davo-Martinez C, Thijssen KL, Vermeulen W, Lans H. Nucleic Acids Res. 2023 Oct 13;51(18):e93. doi: 10.1093/nar/gkad642. 10.1093/nar/gkad642 PubMed 37522336