TccCas13a Twin SUMO
(Plasmid
#199754)
-
PurposeExpresses codon optimized thermostabile TccCas13a in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199754 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneTwin-SUMO
- Backbone size w/o insert (bp) 6076
- Total vector size (bp) 9761
-
Vector typeBacterial Expression
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTccCas13a
-
SpeciesThermoclostridium caenicola
-
Insert Size (bp)3678
- Promoter LacI
-
Tag
/ Fusion Protein
- SUMO (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer gaaattaatacgactcactatagggg
- 3′ sequencing primer caaaaaacccctcaagacccg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TccCas13a Twin SUMO was a gift from Magdy Mahfouz (Addgene plasmid # 199754 ; http://n2t.net/addgene:199754 ; RRID:Addgene_199754) -
For your References section:
Characterization of a thermostable Cas13 enzyme for one-pot detection of SARS-CoV-2. Mahas A, Marsic T, Lopez-Portillo Masson M, Wang Q, Aman R, Zheng C, Ali Z, Alsanea M, Al-Qahtani A, Ghanem B, Alhamlan F, Mahfouz M. Proc Natl Acad Sci U S A. 2022 Jul 12;119(28):e2118260119. doi: 10.1073/pnas.2118260119. Epub 2022 Jun 28. 10.1073/pnas.2118260119 PubMed 35763567