Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TccCas13a Twin SUMO
(Plasmid #199754)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199754 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Twin-SUMO
  • Backbone size w/o insert (bp) 6076
  • Total vector size (bp) 9761
  • Vector type
    Bacterial Expression
  • Selectable markers
    None

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TccCas13a
  • Species
    Thermoclostridium caenicola
  • Insert Size (bp)
    3678
  • Promoter LacI
  • Tag / Fusion Protein
    • SUMO (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer gaaattaatacgactcactatagggg
  • 3′ sequencing primer caaaaaacccctcaagacccg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TccCas13a Twin SUMO was a gift from Magdy Mahfouz (Addgene plasmid # 199754 ; http://n2t.net/addgene:199754 ; RRID:Addgene_199754)
  • For your References section:

    Characterization of a thermostable Cas13 enzyme for one-pot detection of SARS-CoV-2. Mahas A, Marsic T, Lopez-Portillo Masson M, Wang Q, Aman R, Zheng C, Ali Z, Alsanea M, Al-Qahtani A, Ghanem B, Alhamlan F, Mahfouz M. Proc Natl Acad Sci U S A. 2022 Jul 12;119(28):e2118260119. doi: 10.1073/pnas.2118260119. Epub 2022 Jun 28. 10.1073/pnas.2118260119 PubMed 35763567