mCas13 Twin-SUMO
(Plasmid
#199753)
-
PurposeExpresses codon optimized miniature mCas13 for protein expression in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199753 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneTwin SUMO
- Backbone size w/o insert (bp) 6076
- Total vector size (bp) 8705
-
Vector typeBacterial Expression
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCas13
-
SpeciesUnknown
-
Insert Size (bp)2619
- Promoter LacI
-
Tag
/ Fusion Protein
- SUMO (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer gaaattaatacgactcactatagggg
- 3′ sequencing primer caaaaaacccctcaagacccg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCas13 Twin-SUMO was a gift from Magdy Mahfouz (Addgene plasmid # 199753 ; http://n2t.net/addgene:199753 ; RRID:Addgene_199753) -
For your References section:
A Novel Miniature CRISPR-Cas13 System for SARS-CoV-2 Diagnostics. Mahas A, Wang Q, Marsic T, Mahfouz MM. ACS Synth Biol. 2021 Oct 15;10(10):2541-2551. doi: 10.1021/acssynbio.1c00181. Epub 2021 Sep 21. 10.1021/acssynbio.1c00181 PubMed 34546709
Map uploaded by the depositor.
