Skip to main content
Addgene

pAAV.cc84-mut
(Plasmid #199746)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199746 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMCV
  • Backbone size w/o insert (bp) 1799
  • Total vector size (bp) 6088
  • Modifications to backbone
    Inserted AAV2 Rep and AAV.cc84 Cap
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAV.cc84 Cap
  • Species
    Synthetic
  • Insert Size (bp)
    2211
  • Mutation
    mutated amino acids 586-592 in Cap

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer CATGTGGTCACGCTGGGTATTTAAG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV.cc84-mut was a gift from Aravind Asokan (Addgene plasmid # 199746 ; http://n2t.net/addgene:199746 ; RRID:Addgene_199746)

  • For your References section:

    Structure-guided AAV capsid evolution strategies for enhanced CNS gene delivery. Gonzalez TJ, Mitchell-Dick A, Blondel LO, Fanous MM, Hull JA, Oh DK, Moller-Tank S, Castellanos Rivera RM, Piedrahita JA, Asokan A. Nat Protoc. 2023 Sep 21. doi: 10.1038/s41596-023-00875-y. 10.1038/s41596-023-00875-y PubMed 37735235
Related items: