pITR-AAV-Rep2Cap9-GFP
(Plasmid #199744)

• Purpose: Expresses AAV2 Rep and AAV9 Cap, with GFP replacing a region of Cap, within AAV2 ITRs.
• Depositing Lab: Aravind Asokan
• Publication: Gonzalez et al Nat Protoc. 2023 Sep 21. doi: 10.1038/s41596-023-00875-y.

Backbone

• Vector backbone: pSub201
• Backbone manufacturer: The National Gene Vector Biorepository
• Backbone size w/o insert (bp): 5965
• Total vector size (bp): 7747
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AAV9 Cap w/ GFP insert
• Species: Synthetic
• Insert Size (bp): 1785
• Mutation: Replaced amino acids 356-736 in Cap with GFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: ATCATGGGAAAGGTGCCAGAC
• 3′ sequencing primer: GTACAGCTCGTCCATGCCGA

Resource Information

• Supplemental Documents:
  • pITR-AAV-Rep2Cap9-GFP.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry