Skip to main content
Addgene

pcDNA3.1(-)-Green Falcan10
(Plasmid #199707)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199707 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1(-)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Green Falcan10
  • Insert Size (bp)
    1521
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(-)-Green Falcan10 was a gift from Tetsuya Kitaguchi (Addgene plasmid # 199707 ; http://n2t.net/addgene:199707 ; RRID:Addgene_199707)

  • For your References section:

    Development of green fluorescent protein-based cAMP indicators for covering a wide range of cAMP concentrations. Hiasa S, Fujimori T, Aiki S, Ueda H, Tsuboi T, Kitaguchi T. RSC Adv. 2023 May 22;13(23):15514-15520. doi: 10.1039/d3ra01390a. eCollection 2023 May 22. 10.1039/d3ra01390a PubMed 37223420
Related items:
Commonly requested with: