pET28a LZ LED WT-FLAG
(Plasmid
#199679)
-
PurposeBacterial expression of Leucine Zipper (LZ) LYCHOS LED-Flag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199679 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLeucine zipper LYCHOS LED WT
-
Alt nameGPR155
-
SpeciesH. sapiens (human)
-
Entrez GeneGPR155 (a.k.a. DEP.7, DEPDC3, PGR22)
- Promoter T7 promoter
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on backbone)
- Flag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer taatacgactcactataggg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a LZ LED WT-FLAG was a gift from Roberto Zoncu (Addgene plasmid # 199679 ; http://n2t.net/addgene:199679 ; RRID:Addgene_199679) -
For your References section:
Lysosomal GPCR-like protein LYCHOS signals cholesterol sufficiency to mTORC1. Shin HR, Citron YR, Wang L, Tribouillard L, Goul CS, Stipp R, Sugasawa Y, Jain A, Samson N, Lim CY, Davis OB, Castaneda-Carpio D, Qian M, Nomura DK, Perera RM, Park E, Covey DF, Laplante M, Evers AS, Zoncu R. Science. 2022 Sep 16;377(6612):1290-1298. doi: 10.1126/science.abg6621. Epub 2022 Aug 25. 10.1126/science.abg6621 PubMed 36007018