Skip to main content

Myc-βarrestin2-LOV-Turbo_pCDNA3
(Plasmid #199671)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199671 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5366
  • Total vector size (bp) 8057
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LOV-Turbo
  • Alt name
    Light regulated TurboID
  • Species
    Synthetic
  • Insert Size (bp)
    1362
  • Promoter CMV
  • Tags / Fusion Proteins
    • Myc (N terminal on insert)
    • βarrestin2 (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer gcctcgactgtgccttctagtt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Myc-βarrestin2-LOV-Turbo_pCDNA3 was a gift from Alice Ting (Addgene plasmid # 199671 ; http://n2t.net/addgene:199671 ; RRID:Addgene_199671)
  • For your References section:

    Engineered allostery in light-regulated LOV-Turbo enables precise spatiotemporal control of proximity labeling in living cells. Lee SY, Cheah JS, Zhao B, Xu C, Roh H, Kim CK, Cho KF, Udeshi ND, Carr SA, Ting AY. Nat Methods. 2023 May 15. doi: 10.1038/s41592-023-01880-5. 10.1038/s41592-023-01880-5 PubMed 37188954