V5-LOV-Turbo-ERM
(Plasmid
#199664)
-
Purposeexpresses LOV-Turbo on the mammalian ER membrane, lentiviral vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199664 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCW
- Backbone size w/o insert (bp) 7716
- Total vector size (bp) 9465
-
Modifications to backboneTRE3G promoter
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLOV-Turbo
-
Alt nameLight regulated TurboID
-
SpeciesSynthetic
-
Insert Size (bp)1362
- Promoter TRE3G
-
Tags
/ Fusion Proteins
- V5 (N terminal on insert)
- SEC61B (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcagagctcgtttagtgaaccg
- 3′ sequencing primer aaagcagcgtatccacatagcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.03.09.531939v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
V5-LOV-Turbo-ERM was a gift from Alice Ting (Addgene plasmid # 199664 ; http://n2t.net/addgene:199664 ; RRID:Addgene_199664) -
For your References section:
Engineered allostery in light-regulated LOV-Turbo enables precise spatiotemporal control of proximity labeling in living cells. Lee SY, Cheah JS, Zhao B, Xu C, Roh H, Kim CK, Cho KF, Udeshi ND, Carr SA, Ting AY. Nat Methods. 2023 May 15. doi: 10.1038/s41592-023-01880-5. 10.1038/s41592-023-01880-5 PubMed 37188954