Skip to main content
Addgene

pcDNA3.1 GIL-11 myc TEV TwinStrep
(Plasmid #199627)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199627 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    BioCat GmbH
  • Backbone size w/o insert (bp) 5625
  • Total vector size (bp) 6441
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418) ; Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GIL-11
  • Alt name
    Chimeric synthetic cytokine between IL-11 and LIF
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    816
  • GenBank ID
    NC_000022.11 NC_000019.10
  • Promoter T7
  • Tag / Fusion Protein
    • TwinStrep-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer AGGCACAGTCGAGGCTG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The molecule was structure-based in-silico designed. The DNA was then synthesized and ordered from BioCat GmbH

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1 GIL-11 myc TEV TwinStrep was a gift from Jurgen Scheller (Addgene plasmid # 199627 ; http://n2t.net/addgene:199627 ; RRID:Addgene_199627)

  • For your References section:

    Cytokimera GIL-11 rescued IL-6R deficient mice from partial hepatectomy-induced death by signaling via non-natural gp130:LIFR:IL-11R complexes. Rafii P, Seibel C, Weitz HT, Ettich J, Minafra AR, Petzsch P, Lang A, Floss DM, Behnke K, Kohrer K, Moll JM, Scheller J. Commun Biol. 2023 Apr 15;6(1):418. doi: 10.1038/s42003-023-04768-4. 10.1038/s42003-023-04768-4 PubMed 37061565
Related items: