pcDNA3.1 GIL-11 myc TEV TwinStrep
(Plasmid #199627)

• Purpose: Eucaryotic expression plasmid for chimeric cytokine of IL-11 and LIF (GIL-11) with a TwinStrep-tag
• Depositing Lab: Jurgen Scheller
• Publication: Rafii et al Commun Biol. 2023 Apr 15;6(1):418. doi: 10.1038/s42003-023-04768-4.

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: BioCat GmbH
• Backbone size w/o insert (bp): 5625
• Total vector size (bp): 6441
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418) ; Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GIL-11
• Alt name: Chimeric synthetic cytokine between IL-11 and LIF
• Species: H. sapiens (human)
• Insert Size (bp): 816
• GenBank ID: NC_000022.11 NC_000019.10
• Promoter: T7
• Tag / Fusion Protein:
  • TwinStrep-tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: AGGCACAGTCGAGGCTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The molecule was structure-based in-silico designed. The DNA was then synthesized and ordered from BioCat GmbH

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry