-
Purpose(Empty Backbone) Expresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and blasticidin resistance from EF-1a promoter.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199622 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneLentiGuide puro
- Backbone size (bp) 9582
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJulian Pulecio
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Blasticidin resistance was cloned from lenti dCAS-VP64_Blast to substitute the original puromycin resistance from LentiGuide Puro(#52963).
Please visit https://www.biorxiv.org/content/10.1101/2023.03.07.531569v1 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiGuide Blast was a gift from Danwei Huangfu (Addgene plasmid # 199622 ; http://n2t.net/addgene:199622 ; RRID:Addgene_199622) -
For your References section:
Dynamic network-guided CRISPRi screen identifies CTCF-loop-constrained nonlinear enhancer gene regulatory activity during cell state transitions. Luo R, Yan J, Oh JW, Xi W, Shigaki D, Wong W, Cho HS, Murphy D, Cutler R, Rosen BP, Pulecio J, Yang D, Glenn RA, Chen T, Li QV, Vierbuchen T, Sidoli S, Apostolou E, Huangfu D, Beer MA. Nat Genet. 2023 Aug;55(8):1336-1346. doi: 10.1038/s41588-023-01450-7. Epub 2023 Jul 24. 10.1038/s41588-023-01450-7 PubMed 37488417
Map uploaded by the depositor.
