Skip to main content
Addgene

AAVS1-idCas9-KRAB-Hygro donor
(Plasmid #199621)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199621 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAVS1-donor
  • Total vector size (bp) 11249
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AAVS1-idCas9-KRAB-Hygro
  • Insert Size (bp)
    8384

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MfeI (unknown if destroyed)
  • 3′ cloning site PacI (unknown if destroyed)
  • 5′ sequencing primer GTTCTGGCAAGGAGAGAGATG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Julian Pulecio

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

dCas9-KRAB was cloned from AAVS1-idCas9-KRAB-Blast donor and inserted into Hygro resistant AAVS1 backbone.

Please visit https://www.biorxiv.org/content/10.1101/2023.03.07.531569v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-idCas9-KRAB-Hygro donor was a gift from Danwei Huangfu (Addgene plasmid # 199621 ; http://n2t.net/addgene:199621 ; RRID:Addgene_199621)

  • For your References section:

    Dynamic network-guided CRISPRi screen identifies CTCF-loop-constrained nonlinear enhancer gene regulatory activity during cell state transitions. Luo R, Yan J, Oh JW, Xi W, Shigaki D, Wong W, Cho HS, Murphy D, Cutler R, Rosen BP, Pulecio J, Yang D, Glenn RA, Chen T, Li QV, Vierbuchen T, Sidoli S, Apostolou E, Huangfu D, Beer MA. Nat Genet. 2023 Aug;55(8):1336-1346. doi: 10.1038/s41588-023-01450-7. Epub 2023 Jul 24. 10.1038/s41588-023-01450-7 PubMed 37488417
Related items:
Commonly requested with: